Club Agapornis

Forum du CFA (Comité Français Agapornis) dédié à l'élevage des Agapornis plus communément appelés Inséparables.

Vous n'êtes pas connecté. Connectez-vous ou enregistrez-vous

Le retour

Aller en bas  Message [Page 1 sur 1]

1 Le retour le Lun 23 Mai - 20:37

Rik

avatar
Administrateur
Administrateur
GENERALITES

Nous sommes constitués de 2 grands types cellulaires :
-les cellules germinatives = cellules sexuelles ou gamètes
-les cellules somatiques = toutes les autres
Dans le noyau de ces cellules se trouve l’information génétique de l’individu portée par les molécules d’ADN assemblées en chromosomes. 2 types de chromosomes :
-les autosomes = chromosomes non sexuels
-les gonosomes = chromosomes sexuels (noté X ou Y chez l’Homme)

Dans le noyau des cellules somatiques:
46 chromosomes = 44 autosomes + 2 gonosomes (X et X si femme, X et Y si homme) Ces 46 chromosomes sont par paires (on parle de paires de chromosomes homologues)
soit 23 paires de chromosomes = 22 paires d’autosomes +1 paire de gonosomes (XX ou XY )

Dans le noyau des cellules germinatives ou gamètes :
23 chromosomes , soit la moitié de l’information génétique contenue dans les cellules somatiques = 22 autosomes célibataires + 1 gonosome X ou Y
(en fait à chaque fois on n’a plus qu’un seul des 2 chromosomes de la paire initiale)

C’est la réunion de deux gamètes lors de la fécondation (gamète mâle + gamète femelle) qui va déterminer les caractères et le sexe du nouvel individu.

Spermatozoïde + Ovule = Cellule-oeuf
(23 chromosomes) (23 chromosomes) ( 46 chromosomes = 23paires )

Remarque: Chaque espèce possède un nombre de chromosomes bien définit
-46 chez l’Homme (comme pour les cochons, hi hi...)
(soit 23 paires =22 paires d’autosomes + 1 paire de gonosomes)
-18 chez les Passerines (soit 9 paires = 8 paires d’autosomes + 1 paire de gonosomes)
-26 chez les Psittacidés auxquels nos inséparables appartiennent
(soit 13 paires au total = 12 paires d’autosomes + 1 paire de gonosomes)

Chaque chromosome correspond à une molécule d’ADN (Acide Désoxy Ribonucléique) qui constitue le support de l’information génétique.
Une molécule d’ADN est en fait un enchaînement de nucléotides, on distingue 4 types de nucléotides A , T, C et G (Adénine, Thymine , Cytosine, et Guanine )
Un gène désigne donc une séquence plus ou moins longue de nucléotides de l’ADN localisée en un point précis ou locus d’une paire de chromosomes homologues.

Exemple de séquence nucléotidique :

CGATGATGCTGATCGTAGCTACGCATGCTGCAGGAG
|__________________________|
1 gène

Cet enchaînement particulier de nucléotides va être traduit en protéine par le biais de processus complexes. Enfin cette protéine va avoir une fonction spécifique dans l’organisme comme la production de pigments par exemple (mélanine, etc…)

Cependant, pour une protéine donnée, il peut exister différentes « versions » du gène nommées allèles . On dit donc qu’un gène a plusieurs allèles ou formes alléliques.
Il est donc possible que ces allèles du gène codent pour des protéines qui ont une activité très différente, l’une pourra être active et permettre la production de pigments tandis que l’autre ne le sera pas…

Du fait des paires de chromosomes homologues, il peut y avoir en présence 2 allèles différents du gène ou au contraire 2 fois le même allèle.
Pour un gène donné, on nommera génotype, la garniture allélique de l’individu c’est à dire la nature des deux allèles présents dans le génome et phénotype le caractère élémentaire qui résulte de l’expression de ce génotype.

Ainsi :
·si les deux allèles sont identiques alors l’individu est homozygote pour le gène considéré, le phénotype est directement déterminé
·si, en revanche les deux allèles sont différents (individu est hétérozygote pour ce gène) le phénotype résultera de leur confrontation :
-l’un peut être dominant et l’autre récessif, (cas de dominance / récessivité d’une mutation)
-ou bien le phénotype peut refléter un caractère intermédiaire, on est alors dans un cas de codominance des deux allèles ( la descendance présentera un phénotype intermédiaire à celui des parents)

Ce sont des mutations dans la séquence nucléotidique (par délétion ou addition ou simple substitution d’un nucléotide ou de plusieurs nucléotides de l’ADN ) qui sont à l’origine des différents allèles du gène.
On parle de mutation - autosomique si elle atteint les autosomes .
- gonosomique (ou liée au sexe) si elle touche les chromosomes sexuels

Voir le profil de l'utilisateur http://www.agaporniden.be

2 Re: Le retour le Lun 23 Mai - 20:38

Rik

avatar
Administrateur
Administrateur
DONNEES PREALABLES SUR LES MUTATIONS AUTOSOMIQUES

I ) Exemple de mutation autosomique récessive :

On considère un gène autosomique à 2 allèles :
A = allèle sauvage
a = allèle muté
avec A>a (« > » A dominant sur a)
On a donc 3 génotypes possibles pour l’individu mais seulement 2 phénotypes:
AA ( génotype homozygote dominant ) [A]
Aa ( génotype hétérozygote) [A]
aa ( génotype homozygote récessif) [a]

[A]= phénotype dominant
[a]= phénotype récessif

Application :
Par exemple c’est le cas de la mutation bleue en simplifiée :

1 gène, 2 allèles : vert noté bl*+
bleu noté bl
avec bl*+>bl ( vert ‘dominant’ sur bleu)

soit 3 génotypes possibles :

bl*+ / bl*+ ( génotype homozygote dominant ) [bl*+] oiseau vert
bl*+/ bl (génotype hétérozygote) [bl*+] oiseau vert porteur de bleu
bl / bl ( génotype homozygote récessif) [ bl] oiseau bleu

[bl*+]= phénotype dominant = oiseau vert
[bl]= phénotype récessif = oiseau bleu

Chez l’ oiseau vert porteur de bleu l’allèle vert bl+ masque l’allèle bl que l’on ne peut ainsi suspecter avec le phénotype (qu’il soit porteur de bleu ou pas, l’oiseau est de phénotype vert)

II ) Exemple de mutation autosomique codominante:

On considère un gène autosomal à 2 allèles :
A = allèle sauvage
a = allèle muté
On a donc 3 génotypes possibles pour l’individu et aussi 3 phénotypes:
AA ( génotype homozygote ) [A]
Aa ( génotype hétérozygote) [Aa]
aa ( génotype homozygote [a]

[A]
[Aa] = phénotype intermédiaire ( les 2 allèles pèsent le même « poids »)
[a]

Application :
Par exemple c’est le cas des fleurs de ‘Belle de nuit’, lorsque l’on croise des plants parentaux à fleurs rouges et des plants à fleurs blanches on obtient des plants à fleurs roses.

1 gène, 2 allèles : rouge noté R
blanc noté B
On a donc 3 génotypes possibles pour l’individu et aussi 3 phénotypes:
RR ( génotype homozygote ) [R]
RB ( génotype hétérozygote) [RB]
BB ( génotype homozygote ) [B]
avec:
[R]= fleurs rouges
[RB] = phénotype intermédiaire ( les 2 allèles pèsent le même « poids ») = fleurs roses
[B]= fleurs blanches

DONNEES PREALABLES SUR LES MUTATIONS GONOSOMIQUES

Chez tous les Mammifères une paire de chromosomes est différente et dépend du sexe, les gonosomes :
La femelle possède une paire de chromosomes X ( Homozygote : en formule X / X)
Le mâle a un chromosome X et un chromosome Y (Hétérozygote : en formule X / Y).

Chez les Oiseaux par contre c’est l’inverse :
Le mâle est homozygote et possède 2 chromosomes Z ( en formule :Z / Z)
La femelle a un chromosome Z et un chromosome W (en formule : Z / W) et est donc hétérozygote.

De plus, le chromosome W ne représente que le 1/3 de la longueur du chromosome Z et l’on sait aujourd’hui qu’il ne porte pas de gène connu susceptible d’influencer la couleur de l’oiseau.

Remarque : Vous n’avez jamais entendu les mots homo et hétéro?
Homo : le même
Hétéro : divers
Les zygotes sont ou Z , ou W .
Homozygote est Z /Z ; hétérozygote est Z / W.


Mâle x femelle =
Z / Z x Z / W.
1…2…3….4
(J’ai mis des chiffres en bas des zygotes)

Le premier Z du mâle peut se lier avec ou le premier Z de la femelle ou avec le W de la femelle. Le deuxième Z du mâle : pareil.
1 + 3 = Z / Z
1 + 4 = Z / W
2 + 3 = Z / Z
2 + 4 = Z / W.

Le résultat théorique est : 50 % de mâles et 50 % de femelles

Comme nous l’avons dit précédemment on ne connaît pas de gènes associés au chromosome W. On connaît par contre les gènes suivants qui peuvent s’attacher au gonosome Z :
- SL ino (ou son frère pallid)
- cinnamon
- opaline

Voir le profil de l'utilisateur http://www.agaporniden.be

3 Re: Le retour le Lun 23 Mai - 20:39

Rik

avatar
Administrateur
Administrateur
MUTATIONS


Une mutation est une variation de l’original : l’original est toujours vert.

On considèrera 4 modes de transmission:

Autosomique récessive : le gène se trouve sur une paire de chromosomes autosomiques et doit être présent dans les deux allèles pour être visible.
Autosomique dominante : la présence d’un seul allèle montre déjà sa présence vis-à-vis de la couleur sauvage.
Il n’y a alors pas de différence visuelle entre simple facteur (sf) et double facteur (df), en revanche, chez les mutations dominantes incomplètes il y a une différence visuelle entre sf et df

Récessive liée au sexe (gonosomique récessive) : chez les mâles le gène se trouve sur le pair des chromosomes « Z » et doit être présent dans les deux allèles pour être visible. Les femelles montrent le facteur déjà quand présent sur leur seul Z chromosome parce que ce n’est pas corrigé par le chromosome W qui est quasi vide.
Dominante lié au sexe (gonosomique dominante) : la présence d’un allèle muté déjà change le phénotype du male. Existe déjà chez les Goulds, pas encore chez les Inséparables.


_____________________________________________________________


Ce système est d’origine Anglais. Les noms des gènes sont des noms Anglais.
[ Ex : « D » pour Dark factor ou facteur foncé
« of » pour orange-faced ou masque orange.
C’est un peu comme dans le foot : on use les termes originaux comme penalty, corner, goal... ]

1ère colonne : nom de la mutation
2ème colonne : allèle sauvage
3ème colonne : allèle muté

Remarques
On note les allèles :
-en minuscules pour une mutation récessive
-en majuscules pour une mutation dominante

SL = sex-linked = liée au sexe
NSL = no sex-linked = pas liée au sexe.


ROSEICOLLIS

· Autosomiques récessives : (NSL)
Aqua…………………………….bl*+………...bl*aq ( 1° )
Turquoise……………………….bl*+………...bl*tq ( 1° )
edged dilué…………….….…...ed*+………..ed
Bronze fallow…………………..a*+………….a*bz ( 2° )
Pale fallow ………………….….pf*+…………pf
Masque orange………..…….…of*+………...of
Panache récessif....……...…....s*+………….s

· Autosomiques dominantes : (NSL)
Panache dominante.…………..Pi*+…………Pi

· Autosomiques dominantes incomplètes (codominantes) : (NSL)
Facteur foncé………..….……. D*+………….D
Masque rose……………………Ph*+……..…Ph
Violet………………..…………. V*+……….…V

· Gonosomiques récessives : (liées au sexe= SL )
Cinnamon………………..…….cin*+……..…cin
Opaline ………………………..op*+…………op
SL ino……………..………….. ino*+……...…ino ( 3° )
Pallid………………………..… ino*+…...……ino*pd ( 3° )


PERSONNATA ET FISCHER

· Autosomiques récessives : (NSL)
NSL ino…………….…………...a*+……….…a ( 4° )
Pastel …………………………..a*+……….…a*pa ( 4° )
Clair au yeux noires……..…….a*+…………a*dec ( 4° )
Bleu…………………………..…bl*+………...bl
Pale fallow………….….……....pf*+………...pf
Mottle………………….... ….....mo*+……….mo
(concernant cette dernière mutation mottle on ne connait pas encore réellement le déterminisme génétique mais on la suppose être autosomique récessive)

Panache récessif……….……..s*+………....s
Dilute…………………..…….…dil*+………..dil

· Autosomiques dominantes : (NSL)
Misty…………………......……...Mt*+…….…Mt
Panache dom…………………..Pi*+……......Pi
Slaty………………….…..……..Slt*+………..Slt

· Autosomiques dominantes incomplètes (codominantes) : (NSL)
Violet…………………….. ……..V*+……….V
Facteur foncé……………..…….D*+.……...D
Edged……………….…...……...E*+……….E


Avec:
1°) Cas du facteur Bleu à multiples allèles ( bl ; bl*tq ; bl*aq )
2°) Très probablement un allèle supplémentaire du facteur NSL ino (encore non
existante en roseicollis).
3°) Cas du facteur SL ino à multiples allèles ( ino ; ino*pd )
4°) Cas du facteur NSL ino à multiples allèles ( a ; a*pa ; a*dec )

___________________________________________________________

C'était donc juste pour introduire les notations utilisées pour toutes les mutations que nous détaillerons par la suite

Voir le profil de l'utilisateur http://www.agaporniden.be

4 Re: Le retour le Lun 23 Mai - 20:39

Rik

avatar
Administrateur
Administrateur
Dans la suite, nous allons tt d'abord traiter des mutations autosomiques

PIGMENTS et OISEAU SAUVAGE

Les Inséparables n’ont pas de pigments vert ni de pigment bleu.
Ils n’ont que des pigments noirs et de pigments jaunes à rouges.
- Le noir s’appelle eumélanine ou mélanine.
- Le jaune à rouge psittacofulvine
Cependant, une partie de la plume peut produire de la lumière bleu mais seulement sur un fond de noir. Ainsi : pas de mélanine =pas de noir = pas de bleu.

Vert est donc:
lumière bleu sur une base noire traversant une couche de pigment jaune ou
vert = (bleu sur noir) + jaune

Si vous voulez des détails sur les plumes et la production des couleurs, achetez le livre de Dom ou visitez le site www.agapornis.be .

Croisement :

Parent1 : Vert X Parent2 : Vert
soit leurs génotypes respectifs: bl*+ / bl*+ X bl*+ / bl*+
Les deux individus du couple ne peuvent fournir qu’un seul type de gamètes présentant toutes l’allèle bl*+ du gène
donc on aura 100% d’oiseaux verts ( génotype homozygote dominant: bl*+/bl*+ ) dans la descendance de ce couple.

FACTEUR BLEU(=mutation autosomique récessive )

Nous allons commencer par la mutation la plus anciennement connue : bleu
Il existe 3 types de bleu dus aux trois allèles du gène : bleu, aqua et turquoise (qui se trouvent donc au même locus.)
Bleu - absence totale de psittacofulvines (pigments jaune à rouge)
Aqua - diminution de 50 % de psittacofulvines
Turquoise - diminution de 50 % sur le dos et de 90 % sur le ventre.

Symboles
Vert : bl*+
Bleu : bl
Aqua : bl*aq
Turquoise : bl*tq

Remarques :
- Chez les roseicollis, le vrai bleu n’existe pas, nous n'avons que l'aqua et le turquoise ( et intermédiaire AquaTurquoise).
- Chez les personatus et fischeris, ni aqua ni turquoise existent.
- Chez d’autres espèces on a :
bleu et aqua chez les splendides (Neophema splendida)
bleu, aqua et turquoise chez la perruche collier (Psittacula krameri).

On sait que les allèles peuvent donner des phénotypes intermédiaires :
Ordre de dominance : Vert > aqua > bleu.
turquoise

Aqua bl*aq / bl*aq
AquaTurquoise bl*aq / bl*tq
AquaBleu bl*aq / bl
Turquoise bl*tq / bl*tq
TurquoiseBleu bl*tq / bl
Bleu bl / bl

Remarque : Pour les combinaisons des allèles on écrit les deux allèles dans un mot avec une lettre capitale. C’est une convention pour éviter les erreurs des soi-disant porteurs.


Croisement :
Parent1 : Bleu X Parent2 : Bleu
soit bl / bl X bl / bl
idem que le croisement 1 on aura 100% de bleu ( génotype homozygote récessif : bl/bl) car un seul type de gamètes pour les 2 parents ( porteurs de l’allèle bl du gène).


Croisement :
Parent1 : Vert X Parent2 : Bleu
soit bl*+ / bl*+ X bl / bl

Parent 1 peut fournir 1 type de gamètes : bl*+
Parent 2 peut fournir 1 type de gamètes : bl

soit dans la descendance on a 100% d’oiseaux au génotype bl*+/bl (donc hétérozygote)
c’est à dire des oiseaux au phénotype vert mais porteurs de bleu que l’on notera Vert / Bleu (attention : ce slash là ‘ / ’ signifie dans ce cas ‘porteur de’, ce n’est pas la même signification que pour celui utilisé dans l’écriture du génotype qui sert juste à séparer les deux allèles du gène que présente l’individu.)

Croisement :
Parent1 : Vert X Parent2 : Vert / Bleu
soit bl*+/bl*+ X bl*+/bl

Parent 1 peut fournir 1 type de gamètes : bl*+
Parent 2 peut fournir 2 type de gamètes : bl ou bl*+
Soit dans la descendance : 50% de bl*+/bl*+ soit vert
50% de bl*+/bl soit vert/bleu

Croisement :
Parent 1: Bleu X Parent 2 : Vert / Bleu
soit bl/bl X bl*+/bl
Parent 1 peut fournir 1 type de gamètes : bl
Parent 2 peut fournir 2 type de gamètes : bl ou bl*+
Soit dans la descendance : 50% de bl / bl soit bleu
50% de bl*+/bl soit vert/bleu

Croisement :

Parent 1: Vert / Bleu X Parent 2 : Vert / Bleu
soit bl*+/bl X bl*+/bl
Parent 1 peut fournir 1 type de gamètes : bl ou bl*+
Parent 2 peut fournir 2 type de gamètes : bl ou bl*+
Soit dans la descendance : 25% de bl / bl soit bleu
50% de bl*+/bl soit vert/bleu
25% de bl*+/ bl*+ soit vert

Voir le profil de l'utilisateur http://www.agaporniden.be

5 Re: Le retour le Lun 23 Mai - 20:40

Rik

avatar
Administrateur
Administrateur
FACTEUR FONCE
(= mutation autosomique codominante)

Nous ne connaissons pas seulement bleu, mais aussi bleu D et bleu DD. ( et respectivement vert, vert D et vert DD)
Sur la même paire de chromosome que le facteur bleu on trouve le locus du gène pour le facteur foncé, symbolisé par D (de Dark factor).
Deux facteurs sur le même chromosome sont dits liés ; on symbolise ça avec un « _ ». Deux gènes localisés sur le même chromosome sont transmis ensemble. Donc la formule pour un oiseau bleu n’est pas bl /bl simplement mais D*+_bl / D*+_bl.

D possède un mode d’hérédité semi dominant.
La cause du facteur foncé est une diminution de diamètre de la zone éponge des barbes des plumes.

[ Remarque:
Comme aqua et turquoise se trouvent au même locus que bleu le facteur foncé dans ces cas se transmettra de façon identique.]


En série bleue :
Bleu ( 0 facteur foncé) D*+_bl / D*+ _bl
Bleu D= Cobalt ( 1 facteur foncé) D*+_bl / D _bl
Bleu DD= Mauve (2 facteur foncé) D_bl / D_bl

En série verte :
Vert ( 0 facteur foncé) D*+_bl*+ / D*+_bl*+
Vert D = Foncé ( 1 facteur foncé) D*+_bl*+ / D_bl*+
Vert DD = Olive ( 2 facteur foncé) D_bl*+ / D_bl*+


Croisement :
vert D X vert D on obtient des verts , des verts D et des verts DD.
soit: D_bl*+ / D*+_bl*+ X D_bl*+ / D*_bl*+
25 % D*+_bl*+ / D*+_bl*+ = vert
50 % D_bl*+ / D*+_bl*+ = vert D
25 % D_bl*+ / D_bl*+ = vert DD.

Bien sur on a aussi voulu des bleus D et des bleus DD aussi. Et ça donnait des problèmes car avec les deux croisement suivants on obtient toujours pas de bleu D :

Croisement :
vert D X bleu soit
D_bl*+ / D*+_bl*+ X D*+_bl / D*+_bl
ne peut donner que
D_bl*+ / D*+_bl =50 % vert D / bleu
D*+_bl*+ / D*+_bl =50 % vert / bleu

Croisement :
vert D / bleu X vert D / bleu ne donnait que
25 % bleu
50 % vert D / bleu
25 % vert DD

Type I et type II :

Il existe en fait 2 formes de vert D / bleu (vert foncé / bleu) :
- vert D / bleu type I soit D_bl*+ / D*+_bl
Le facteur foncé D est lié au bl*+ (vert).
(et c’est celui que l’on a considéré pour le croisement précédent)
- vert D / bleu type II soit D*+_bl*+ / D_bl
Le facteur foncé D est lié au bl (bleu).

Peu d’importance ? Au contraire ! Un pas plus loin :

Croisement: vert D / bleu type I x bleu
Soit D_bl*+ / D*+_bl X D*+_bl / D*+_bl
ne peut donner que
D_bl*+ /D*+_bl = 50% vert D/ bleu type I
D*+_bl /D*+_bl = 50% bleu.

Croisement : vert D / bleu type II x bleu
Soit D*+_bl*+ / D_bl X D*+_bl / D*+_bl
par contre donne:
D*+_bl*+ / D_bl = vert D porteur de bleu type II.
D*+_bl*+ / D*+_bl = vert porteur de bleu
D_bl / D*+_bl = bleu D (cobalt)


Explications : pour obtenir un vert D / bleu type II

Voici un vert D / bleu type I :

IIIIIIIIII D IIIIIIIIIIIIIIIIIIIIII bl*+ IIIIII
Une patte du chromosome où se trouve le facteur foncé ET où se ne trouve pas bleu.

IIIIIIIIII D*+ IIIIIIIIIIIIIIIIIIIIIII bl IIIIII
La deuxième patte n’a pas de facteur foncé mais seulement le facteur bleu.

Les deux pattes opposées mises côte à côte (avant le crossing over ):
IIIIIIIIII D IIIIIIIIIIIIIIIIIIIIIII bl*+ IIIIII
IIIIIIIIII D*+ IIIIIIIIIIIIIIIIIIIIIII bl IIIIII

Il nous faut obligatoirement un phénomène dit de crossing over (CO) pour lier le D au bl c’est à dire qu’il se produit un échange de portion de chromosome soit après le crossing over :

IIIIIIIIII D IIIIIIIIIIIIIIIIIIIIIII bl IIIIII
IIIIIIIIII D*+ IIIIIIIIIIIIIIIIIIIIIII bl*+ IIIIII
Et voici le D lié au bl !!
Cet oiseau est toujours vert D/ bleu, mais on parle alors de vert D / bleu type 2.


Heureusement la nature nous aide un peu, la fréquence de crossing over entre D et bl est de 14 %, donc 1 sur 7 vert D/bleus sera de type 2. ( Le crossing over du facteur foncé arrive une fois sur 7 accouplements environ )
Si vous avez un vert porteur de bleu type I seulement ça peut durer avant que vous n’ayez le premier bleu D.
Et une fois que l’on a un bleu D ce n’est plus difficile d’arriver à bleu DD.

Voir le profil de l'utilisateur http://www.agaporniden.be

6 Re: Le retour le Lun 23 Mai - 20:41

Rik

avatar
Administrateur
Administrateur
FACTEUR VIOLET
(= mutation autosomique codominante)

Le facteur violet est symbolisé par la lettre V et se retrouve au niveau d’une autre paire de chromosome que celle porteuse des facteurs bleu et foncé.

Ainsi, on peut rajouter le facteur violet aux couleurs précédentes ce qui donnera :

1. Bleu.............................................bl_D*+ / bl_D*+ ; V*+ / V*+
2. Bleu sf violet..............................bl_D*+ / bl_D*+ ; V*+ / V
3. Bleu df violet..............................bl_D*+ / bl_D*+ ; V / V
4. Bleu D........................................bl_D*+ / bl_D ; V*+ / V*+
5. Bleu D sf violet..........................bl_D*+ / bl_D ; V*+ / V
6. Bleu D df violet.........................bl_D*+ / bl_D ; V / V
7. Bleu D D....................................bl_D / bl_D ; V*+ / V*+
8. Bleu D D sf violet.....................bl_D / bl_D ; V*+ / V
9. Bleu D D df violet.....................bl_D / bl_D ; V / V

Avec :
2 = bleu avec une couche légère de violet
3 = presque identique à 4. Dessous les ailes on peut remarquer un peu de violet.
5 et 6 = le "vrai" violet. df violet est peut être un peu plus intense que sf violet.
8 et 9 = le double facteur foncé rend le violet invisible. Bien sur il y a une teinte violette mais on doit y regarder d’assez près. Une combinaison qui n’est pas conseillée.

Voir le profil de l'utilisateur http://www.agaporniden.be

7 Re: Le retour le Lun 23 Mai - 20:41

Rik

avatar
Administrateur
Administrateur
FACTEUR NSL INO
(= mutation non liée au sexe et récessive)

Le facteur NSL ino se trouve à nouveau sur une autre paire de chromosomes que celles citées pour les facteurs précédents. Le facteur NSL ino a plusieurs allèles qui sont pastel et dark eyed clear (dec) :
NSL ino - 100 % réduction de mélanine.
Pastel - 50 % réduction de mélanine
Dec - 90-95 % de réduction de mélanine.
(Un dec vert est identique à un lutino si ce ne sont ses yeux , ses pattes et ses ongles qui sont noirs. De plus, le croupion est bleu très clair.).

Symboles
Sauvage a*+
Pastel a*pa
Dec a*dec
NSL ino a

Remarque : J’écrirais pastel vert plutôt que vert pastel afin d’éviter toute confusion avec vert/pastel qui se prononce aussi « vert pastel » (en fait il faudrait dire vert porteur de pastel).

Croisement :

Parent 1: Vert X Parent 2 : ino
soit : D*+_bl*+ / D*+_bl*+ ; a*+ / a*+ X D*+_bl*+ / D*+_bl*+ ; a / a

Parent 1 peut fournir 1 type de gamètes : D*+_bl*+, a*+
Parent 2 peut fournir 1 type de gamètes : D*+_bl*+, a
Soit dans la descendance : 100% D*+_bl*+ / D*+_bl*+ ; a*+/ a c’est à dire vert/ino

De la même manière, les croisement Vert X Pastel vert ou Vert X Dec vert ne donnent respectivement que des vert/pastel ou vert / dec.


Croisement Parent 1: vert/ino X Parent 2 : vert/ino
soit : D*+_bl*+ / D*+_bl*+ ; a*+ / a X D*+_bl*+ / D*+_bl*+ ; a*+ / a

Parent 1 peut fournir 2 types de gamètes : D*+_bl*+, a et D*+_bl*+ , a*+
Parent 2 peut fournir 2 types de gamètes : D*+_bl*+, a et D*+_bl*+ , a*+
Soit dans la descendance :
25 % vert = D*+_bl*+ / D*+_bl*+ ; a*+/ a*+
50 % vert/ino = D*+_bl*+ / D*+_bl*+ ; a*+/ a
25 % ino = D*+_bl*+ / D*+_bl*+ ; a / a

Remarque : Il n’y a pas de différence visuelle entre vert et vert/ino, les verts et les verts/ino présentent donc le même phénotype (et donc le croisement précédent ne permet pas de les identifier)
Cependant, comme la proportion des oiseaux ino au début était assez faibles on devait les mettre contre des verts ou contre un autre couleur bien établie assez costaud et viable.


Cas des PastelIno :

Quelqu’un a découvert que pastel vert X lutino donnait un pastel assez clair avec des rémiges blanches (en effet, dans la plupart des cas les rémiges sont blanches ce qui permet de les distinguer d’un simple pastel vert chez lequel les rémiges sont plus grisâtres) donc le facteur ino était visuellement reconnaissable.
Ce phénotype souvent est nommé pastel/ino (pastel porteur de ino, génotype : a*pa / a), ce qui est incorrect car c’est un phénotype intermédiaire, pas un pastel. Les résultats de quelques accouplements le prouvent :
- si c’était réellement pastel/ino (pastel porteur de ino) le résultat de pastel/ino X pastel devait être 50 % pastel et 50 % pastel / ino les deux présentant un phénotype identique.

- Or, le résultat réel est bien 50 % pastel et 50 % PastelIno, soit deux phénotypes différents. ( Les PastelIno étant trop clairs pour être un pastel ou trop foncé pour un ino.)

Remarque : Il y aura les mêmes possibilités entre (pastel et dec) et entre (dec et ino).

Au niveau des génotypes, les formules possibles sont :

D*+_bl*+ / D*+_bl*+ ; a*+ / a*+ = vert
D*+_bl*+ / D*+_bl*+ ; a * + / a*pa = vert/pastel
D*+_bl*+ / D*+_bl*+ ; a* + / a*dec ; = vert/dec
D*+_bl*+ / D*+_bl*+ ; a*+ / a = vert/ino
D*+_bl*+ / D*+_bl*+ ; a *pa / a*pa = pastel vert
D*+_bl*+ / D*+_bl*+ ; a*pa / a*dec = PastelDec
D*+_bl*+ / D*+_bl*+ ; a*pa / a = PastelIno
D*+_bl*+ / D*+_bl*+ ; a*dec / a*dec = dec jaune
D*+_bl*+ / D*+_bl*+ ; a*dec / a = DecIno jaune
D*+_bl*+ / D*+_bl*+ ; a / a = lutino

Remarques :

- Je rappelle que pour les combinaisons des allèles on écrit les deux allèles dans un mot avec une lettre capitale. )
- PastelDec, PastelIno et DecIno ne sont pas des phénotypes pour les expositions. En effet, ils sont trop variables en couleur vue leur origine bi-allélique donc on ne peut pas améliorer leur couleur. Dans un nid de deux PastelInos vous pouvez en avoir un qui est PRESQUE pastel vert et l’autre qui est PRESQUE dec (c’est à dire jaune comme un ino mais aux yeux noirs et croupion légèrement bleu)
- Il sera impossible de distinguer un PastelDec et un DecIno vue la variation de réduction de mélanine possible. Ainsi, il est beaucoup mieux de garder ces mutations séparées et d’éviter de faire des combinaisons. On peut faire par exemple vert X ino ou vert X pastel vert ou vert X dec jaune etcetera…

De même, dans la série bleu on pourra avoir :
D*+_bl / D*+_bl ; a * + / a*pa = bleu / pastel
D*+_bl / D*+_bl ; a* + / a*dec ; = bleu / dec
D*+_bl / D*+_bl ; a*+ / a = bleu / ino
D*+_bl / D*+_bl ; a *pa / a*pa = pastel bleu
D*+_bl / D*+_bl ; a*pa / a*dec = PastelDec
D*+_bl / D*+_bl ; a*pa / a = PastelIno
D*+_bl / D*+_bl ; a*dec / a*dec = dec
D*+_bl / D*+_bl ; a*dec / a = DecIno
D*+_bl / D*+_bl ; a / a = albino

Voir le profil de l'utilisateur http://www.agaporniden.be

8 Re: Le retour le Lun 23 Mai - 20:42

Rik

avatar
Administrateur
Administrateur
Nous allons à présent traiter des mutations liées au sexe.

FACTEUR INO SL ET PALLID(=mutation gonosomique récessive)

Ino et pallid sont des allèles

Le gène <<ino >> = réduction de mélanine de 100 %
(le pigment noir n’arrive pas dans le plumage, l’œil et les pattes.)

Rappel : <<vert = (bleu sur noir) + jaune>> et << sans noir pas de lumière bleu.>>.
Ino en combinaison avec vert devient :
« (pas bleu sur pas noir) + jaune » soit « (blanc sur blanc) + jaune = jaune. » soit lutino.

.
L’ino incomplet (= gène « pallid ») = réduction de mélanine de 60 %.
(environ 40 % de mélanine arrive dans le plumage. )

Le PallidIno = réduction de mélanine variable entre 60 % et 90 %.
(Un PallidIno est alors plus jaune qu’un pallid, mais moins jaune qu’un lutino.
On voit aussi des différences dans le couleur du croupion, relative au pourcentage de mélanine présente encore.)


Symboles
Sauvage : ino*+
Ino : ino
Pallid : ino*pd
Ils occupent exactement la même place sur le chromosome Z.
Il est peut être bien de voir pallid comme un « ino incomplet ».

Génétiquement nous avons (sur des mâles):

Z ino / Z ino = un ino = corps jaune, croupion blanc
Z ino*pd / Z ino*pd = un pallid = corps jaune avec une suffusion verte, croupion bleu clair
Z ino / Z ino*pd = un PallidIno = corps presque jaune, croupion vaguement bleu

(Remarque : Notez bien la manière d’écrire PallidIno. On voit à première vue qu’il s’agit de deux allèles du même gène et pas d’un phénotype différent. A comparez à: AquaTurquoise, PastelIno, DecIno et PastelDec, à la différence seule que tous ces derniers sont des gènes sur des chromosomes autosomiques.)


Dans un premier temps, nous allons considérer que le gène « ino » afin de mettre bien à plat le processus de transmission d’une mutation SL .


Cas des mâles :

Z ino / Z ino ; bl*+ / bl*+
Nous avons un male (2 x Z) ; de couleur vert (2 x bl*+) ; avec 2 x ino en plus (donc ino est visible) ce qui donne un « vert ino » traditionnellement appelé « lutino » .

Supposons qu’il y a qu’un allèle modifié, (un ino*+ et un ino) ce qui nous donne :
Z ino*+ / Z ino ; bl*+ / bl*+
Toujours un mâle (2 x Z), toujours vert (2 x bl*+) mais seulement 1 fois ino ce qui est corrigé par le ino*+ or c’est un male vert / ino.

Cas des femelles :

Ino sait bien s’attacher au zygote Z, mais ne « colle » pas au zygote W.
Le W est trop petite pour porter « ino » ou son allèle « ino*+ ».

Z ino / W ; bl*+ / bl*+
Une femelle (Z/W) avec 2 x bl*+ et avec 1 fois ino.
La faute génétique « ino » sur le « Z » n’est pas corrigée par un « ino*+ » sur le « W », donc devient visible. Il ne s’agit donc pas d’une femelle verte/ino mais bien d’une femelle lutino.
(comme le W ne porte rien c’est donc impossible pour une femelle d’être porteur d’ino ou de n’importe quelle autre mutation liée au sexe, les femelles seront forcément mutantes.)

Remarque importante :
Un mâle peut montrer une mutation SL récessif ou être porteur d’une mutation SL récessif , une femelle peut seulement montrer une mutation SL récessif mais pas en être porteuse (voir explication précédement.
Les génotypes possibles sont :
Male lutino
Male vert/ino
Femelle lutino.

Remarque :

- Quelques pas plus loin et au lieu d’un vert je prends un aqua.
Z ino / Z ino ; bl*aqua / bl*aqua
2 x bl*aqua = aqua
2 x ino = ino.
Soit un « aqua ino ».
(Quand je remplace aqua avec turquoise j’aurai donc un « turquoise ino ».)

- Porteur de « lutino » n’existe pas , quand vous dites « bleu porteur de lutino » vous dites en vérité « bleu porteur de vert et ino » ce qui est une bêtise. Bleu est récessif, donc ne peut pas être porteur de vert.

Vert + ino = lutino
Aqua + ino = aqua ino
Turquoise + ino = turquoise ino
Bleu + ino = albinos

Voir le profil de l'utilisateur http://www.agaporniden.be

9 Re: Le retour le Lun 23 Mai - 20:42

Rik

avatar
Administrateur
Administrateur
FACTEURS CINNAMON
(=mutation gonosomique récessive)

Le gène « cinnamon » change la mélanine noire en mélanine brune.
<<ino >> et << cinnamon >> occupent des loci différents sur le chromosome Z.

Voici quelques résultats de croisements possibles

Croisement : mâle cinnamon vert X femelle lutino

Mâle : Z cin ,ino*+ / Z cin ,ino+ ; bl*+ / bl*+
(explications :2 x bl*+ le fait vert mais 2 x cin le rend cinnamon vert. Le male n’est pas ino donc 2 x le ino*+ )

Femelle : Z cin*+, ino / W ; bl*+ / bl*+
(explications : 2 x bl*+ est vert, mais 1 x ino la rend lutino (pas de correction pour le défaut ino sur W) et cin*+ donc pas cinnamon. )

soit Z cin, ino*+ / Z cin, ino*+ ; bl*+ / bl*+ X Z cin*+, ino / W ; bl*+ / bl*+

bl*+ / bl*+ X bl*+ / bl*+ ne peut donner que bl*+ / bl*+ ou vert : oublions ça un instant.
Il nous reste donc:
Z cin, ino*+ / Z cin, ino*+ X Z cin*+, ino / W
1.../…2……….…………..……...3../..4


1+3 : Z cin, ino*+ / Z cin*+,ino = mâle = 2 x Z mais porteur de cinnamon et ino seulement, (1 x cin et 1 x cin*+ ; 1 x ino et 1 x ino*+)
2+3 : Z cin, ino*+ / Z cin*+,ino = idem
1+4 : Z cin, ino*+ / W = femelle (1 x Z et 1 x W) cinnamon (1 x cin )
2+4 : Z cin, ino*+ / W = idem

En rajoutant le vert on obtient:
50% mâles vert/cinnamon/ino (porteur cinnamon et ino)
et 50% femelles cinnamon

Croisement : Mâle lutino x Femelle cinnamon verte
soit Z cin*+, ino / Z cin*+, ino ; bl*+ / bl*+ X Z cin, ino*+ / W ; bl*+ / bl*+
Le calcul marche comme précédement :
50% mâles vert/cinnamon/ino
et 50% femelles lutino


Comme <<ino >> et << cinnamon >> occupent des loci différents sur le chromosome Z, il peut à nouveau se produire des crossing over.

On auras deux loci quelque part:
ZZZZZZZZZZ locus cin ZZZ locus ino ZZZZZZZZZZ

Notre mâle vert/cinnamon/ino peut être visualisé comme :

ZZZZZZZZZZ cin ZZZ ino*+ ZZZZZZZZZZ
Une patte du chromosome où se trouve le facteur cinnamon ET où se ne trouve pas ino.
ZZZZZZZZZZ cin*+ ZZZ ino ZZZZZZZZZZ
L’autre patte où se trouve le facteur ino ET où ne se trouve pas cinnamon.

(Vous voyez bien que la faute cin est annulé par son allèle cin+ ; idem pour ino. )

Il nous faut obligatoirement un phénomène dit de crossing over (CO) pour lier le cin au ino
Après crossing-over :
ZZZZZZZZZZ cin ZZZ ino ZZZZZZZZZZ
ZZZZZZZZZZ cin*+ ZZZ ino*+ ZZZZZZZZZZ

Maintenant cinnamon et ino se trouvent sur la même chromatide, ils sont liés et vont se transmettre ensemble.
Dans les formules on indique ça avec le signe ‘_’.

Z cin_ino / Z cin*+, ino*+ ; bl*+ / bl*+ = vert/cinnamon-ino. (« - » indique la liaison)

La fréquence de crossing over entre ino et cin est de 3 %, donc on aura 3 sur 100 d’obtenir ce crossing over en accouplant cinnamon X ino . Cette chance est trés petite parce que cinnamon et ino sont très proches sur la chromatide.

Si ZZZZZZcinZZZinoZZZZZZ alors peu de chance que le schisme arrive exactement entre cin et ino. (cas réel)
Si ZZZZZZcinZZZZZZZZZZZZZinoZZZZZZ )alors beaucoup plus de chance que le schisme arrive (cas fictif )


Remarque : Ca ne sert a rien mais seulement pour montrer ma connaissance profonde et pour vous troubler avec des mots bizarres encore:
La distance entre deux loci est exprimé en centiMorgan (ou en map units ou en m.u.) Cette mesure est pareille au pourcentage. (Cinnamon et ino sont éloignés de 3 centiMorgan. )


Remarque : Le crossing over de ces facteurs n’est possible que chez le male, qui possède 2 chromosomes Z.


Croisement : mâle vert/ cinnamon-ino X femelle lutino vous auriez un pourcentage de cinnamon-ino visuel.
Voici :
Z *cin_*ino / Z *cin+, *ino+ X Z *cin+, *ino / W
……..1……/………..2 ……………………3…/..4..
(Comme avant on oublie vert x vert qui ne donne que vert.)

1+3 = Z *cin_*ino / Z *cin+,*ino
2+3 = Z *cin+, *ino+ / Z *cin+, *ino
1+4 = Z *cin_*ino / W
2+4 = Z *cin+, *ino+ / W

En rajoutant le vert on obtient :
25% mâles cinnamon-ino vert/ino
25% mâles vert/ino
25% femelles cinnamon-ino vertes
25% femelles vertes


De plus, comme pallid est un allèle d’ino, il est aussi possible de produire un cinnamon-pallid
Mais à quoi ça ressemble, un cinnamon-pallid ou un cinnamon-ino ?

Bien que « ino » sait effacer tout la mélanine noire, « ino » est incapable de faire ça avec la mélanine brune. Les rémiges d’un cinnamon-ino auront donc une touche de brun.
Si « ino complet » (=ino) ne peut pas effacer les traces de brun « ino incomplet » (= pallid) le peut moins encore.
[ Si une litre de l’eau de javel n’enlève pas une tache de votre blouse favorite croyez vous que 4/10 d’une litre (réduction de 60 %) peut arranger l’affaire ? ]
Les rémiges d’un cinnamon-pallid auront donc une touche de brun aussi.
En vérité je ne connais personne qui sache faire la différence entre cinnamon-pallid et cinnamon-ino de visu, bien qu’en théorie le cinnamon-pallid devrait montrer un petit peu plus de brun.

Mais réfléchissons un peu :
même en donnant un nom décoratif (lacewing) à un cinnamon-ino : a-t-on vraiment besoin de ça ?
Pallid vert : jaune avec une suffusion vert, croupion bleu ciel, rémiges gris
PallidIno : jaune avec une légère suffusion vert, croupion bleu pâle, rémiges gris.
Cinnamon-pallid : presque jaune pure, croupion vaguement bleu, rémiges brun-gris
Cinnamon-ino : presque jaune pure, croupion vaguement bleu, rémiges brun-gris
Lutino : jaune pure, croupion blanc, rémiges blanc.

N’est-il pas mieux d’améliorer le pallid vert et le lutino et de se concentrer à perfectionner ces couleurs au lieu de créer un grand nombre des couleurs intermédiaires?
N’oubliez pas : il y a aussi aqua ino (jaune pâle), turquoise ino (jaune pâle/ventre presque blanc) et AquaTurquoise ino (jaune, mais entre lutino et aqua ino).
Rajoutez pallid, PallidIno, cinnamon-pallid, cinnamon-ino et on aura 20 couleurs de jaune que se ressemblent pas mal.
[/u]

Voir le profil de l'utilisateur http://www.agaporniden.be

10 genetique... le Lun 23 Mai - 20:50

Hanneton

avatar
Membre
Membre
Bravo Rik, exactement ce qu'il me fallait...j'ai compris le début
Serge va rire en voyant mon message?
Bon boulot en tout cas!!!

Voir le profil de l'utilisateur

11 Re: Le retour le Lun 23 Mai - 21:04

tommy115

avatar
Modérateur
Modérateur
très instructif....merci rik....

Voir le profil de l'utilisateur

12 Re: Le retour le Mar 24 Mai - 0:15

flodu33

avatar
Administrateur
Administrateur
interressant, après je ne suis pas sur que grand monde comprenne tout, ou cherche à tout comprendre confused

les questions sont les bienvenue pour ceux qui veulent approfondir, on fera au mieux pour essayer d'y répondre ...


_________________
Voir le profil de l'utilisateur

13 Re: Le retour le Mar 24 Mai - 17:45

Sébastien

avatar
Membre Actif
Membre Actif
très utile et très intéréssant merci à toi

Voir le profil de l'utilisateur

14 Re: Le retour le Jeu 26 Mai - 18:21

flodu33

avatar
Administrateur
Administrateur
En vérité je ne connais personne qui sache faire la différence entre cinnamon-pallid et cinnamon-ino de visu, bien qu’en théorie le cinnamon-pallid devrait montrer un petit peu plus de brun.

juste une remarque

la différence se fait au niveau des yeux qui sont rouges pour le cinnamon-ino...en revanche le cinnamon-pallid, j'ai toujours eu du mal à les différencier pour les quelques que j'ai pu voir avec un pallid normal ou PallidIno???


_________________
Voir le profil de l'utilisateur

Revenir en haut  Message [Page 1 sur 1]

Permission de ce forum:
Vous ne pouvez pas répondre aux sujets dans ce forum